Báo cáo khoa học: Intrabodies against the EVH1 domain of Wiskott–Aldrich syndrome protein inhibit T cell receptor signaling in transgenic mice T cells

Intrabodies Against The EVH1 Domain Of Wiskott-Aldrich Syndrome Protein Inhibit T Cell Receptor Signaling In Transgenic Mice T Cells

Tên đề tài: Intrabodies against the EVH1 domain of Wiskott-Aldrich syndrome protein inhibit T cell receptor signaling in transgenic mice T cells

Tác giả: Mitsuru Sato, Ryo Iwaya, Kazumasa Ogihara, Ryoko Sawahata, Hiroshi Kitani, Joe Chiba, Yoshikazu Kurosawa, Kenji Sekikawa

Lĩnh vực: Sinh học phân tử, Miễn dịch học, Công nghệ sinh học

Nội dung tài liệu: Nghiên cứu này trình bày việc phát triển và đánh giá hiệu quả của các intrabody (fragment kháng thể nội bào) đơn chuỗi biến đổi (scFv) nhắm vào miền EVH1 của protein Wiskott-Aldrich (WASP). Các intrabody này được thiết kế để ức chế chức năng của WASP, một protein thích ứng quan trọng trong con đường tín hiệu thụ thể tế bào T (TCR). Các nhà nghiên cứu đã tạo ra chuột biến đổi gen biểu hiện các intrabody này và quan sát thấy sự suy giảm trong tín hiệu TCR, đặc biệt là sản xuất Interleukin-2 (IL-2), mà không ảnh hưởng đến sự định vị của thụ thể. Nghiên cứu cũng đề xuất một phương pháp mới để phân tích chức năng protein nội bào một cách hiệu quả.

Mục lục chi tiết:

• Keywords
• Correspondence
• Intracellularly expressed antibodies (intrabodies) have been used to inhibit the function of various kinds of protein inside cells. However, problems with stability and functional expression of intrabodies in the cytosol remain unsolved. In this study, we show that single-chain variable fragment (scFv) intrabodies constructed with a heavy chain variable (ѴH) leader signal sequence at the N-terminus were translocated from the endoplasmic reticulum into the cytosol of T lymphocytes and inhibited the function of the target molecule, Wiskott-Aldrich syndrome protein (WASP). WASP resides in the cytosol as a multifunctional adaptor molecule and mediates actin polymerization and interleukin (IL)-2 synthesis in the T-cell receptor (TCR) signaling pathway. It has been suggested that an EVH1 domain in the N-terminal region of WASP may participate in IL-2 synthesis. In transgenic mice expressing anti-EVH1 scFvs derived from hybridoma cells producing WASP-EVH1 mAbs, a large number of scFvs in the cytosol and binding between anti-EVH1 scFvs and native WASP in T cells were detected by immunoprecipitation analysis. Furthermore, impairment of the proliferative response and IL-2 production induced by TCR stimulation which did not affect TCR capping was demonstrated in the scFv transgenic T cells. We previously described the same T-cell defects in WASP transgenic mice overexpressing the EVH1 domain. These results indicate that the EVH1 intrabodies inhibit only the EVH1 domain function that regulates IL-2 synthesis signaling without affecting the overall domain structure of WASP. The novel procedure presented here is a valuable tool for in vivo functional analysis of cytosolic proteins.
• Intracellular antibodies (intrabodies) may be useful tools for not only clinical applications such as viral neutralization and cancer therapy but also functional analysis of proteins inside cells. A variety of intrabody formats have been used. Single-chain variable fragments (scFvs) consist of one heavy chain variable region (VH) linked through a flexible peptide spacer, usually a repeated motif of 3 × GGGGS, to one light chain variable (VL).
• Abbreviations
• Impaired TCR signaling in anti-WASP scFv Tg mice
• Results
• Construction of anti-WASP-EVH1 scFvs
• Expression of scFv intrabodies and binding to WASP
• Fig. 1. Selection of WASP EVH1 mAbs for assembling scFvs and aligned amino-acid sequences of the VH and V₁ regions. (A) Immunoprecipitation of T cell lysates with WASP EVH1 mAbs produced by established hybridomas. T cell lysates were immunopre- cipitated with 5 µg-mL¯¹ control mouse IgG (lane 1), clone 17 (lane 2), clone 18 (lane 3), clone 21 (lane 4) or commercially available WASP mAb (lane 5) and analyzed by West- ern blotting with WASP polyclonal antibody. Control T cell lysates were loaded in lane 6. The 30-kDa bands (arrowhead) indicated secondary antibody cross-reactive nonspe- cific proteins. (B) Comparison of deduced amino-acid sequences of the VH and V₁ frag- ments derived from WASP EVH1 mAbs 18 and 21. Shared amino acids are indicated by bars. Leader signal sequences and three complementarity-determining regions are shown in gray boxes. Four framework regions (FR) are marked above the sequence.
• Fig. 2. Constructions of anti-WASP EVH1 scFvs. (A) Cloning of vari- able region of immunoglobulin heavy and light chains from hybri- doma cells producing WASP EVH1 mAb. The arrows represent the following primers used to amplify the antibody fragments: pri- mer 1, 5′-CACCCAAGCTTGCCACCATGGGCAGACTTACTTCTTCATTC-3′; primer 2, 5′-CAGAACCACCACCCCCTGAGGAGACGGTGACTGAGG ATCC-3′; primer 3, 5′-CACCCAAGCTTGCCACCATGCAGGTTACTCT GAAAGAGTC-3′; primer 4, 5′-CACCCAAGCTTGCCACCATGAAATG CAGCTGGGTTATCTTC-3′; primer 5, 5′-CAGAACCACCACCCCCTG AGGAGACGGTGACTGAGGTTCC-3′; primer 6, 5′-CACCCAAGCTT GCCACCATGGAGGTTCAGCTGCAGCAGTCTG-3′; primer 7, 5′-GGT GGAGGAGGTTCTGATGTTTTGATGACCCAAACTCCAC-3′; primer 8, 5′-CGAATGCGGCCGCCCGTTTGATTTCCAGCTTGGTGC-3′; primer 9, 5′-GGTGGAGGAGGTTCTGATGTTGTTCTGACCCAAACTCCACTC-3′; primer 10, 5′-CGAATGCGGCCGCCCGTTTCAGCTCCAGCTTGGTCC-3′; primer 11, 5′-TCAAAACATCAGAACCTCCTCCACCGGATCCTCCAC CTCCAGAACCACCACCCCC-3′; primer 12, 5′-GAACAACATCAGAA CCTCCTCACCGGATCCTCCACCTCCAGAACCACCACCCCC-3′; pri- mer 13, 5′-CGTCTCCTCAGGGGGTGGTGGTTCTGGAGGTGGAG GATCCGGTGGAGGAGGTTCT-3′; primer 14, 5′-CGTCTCCTCA GG GGGTGGTGGTTCTGGAGGTGGAGGATCCGGTGGAGGAGG TTCT-3′. In all primers, underlined sequences indicate restriction site of HindIII and Notl, and bold letters indicate full or part of the (Gly4- Ser)3 linker sequence. (B) Schematic representation of the four scFv formats (SHL, HL, SHL-CL, and HL-CL). Shown are the leader signal sequence, Ѵн region, polypeptide linker (G4S)3, VL region, light chain constant [CL(K)] region and Myc tag sequence.
• Fig. 3. Expression of anti-WASP scFvs and detection of their bind- ing activity to WASP in T cells. (A) Western blot analysis of protein extracts of anti-WASP scFv DNA-transfected T cells. The immuno- blot was probed with Myc tag mAb. (B) In vitro binding assay using GST pull-down. All anti-WASP scFv DNA-transfected T cells were lysed and incubated with GST (G) or GST-WASP15 (W) fusion pro- tein noncovalently bound to glutathione-Sepharose beads. Bound proteins were analyzed by Western blotting with Myc tag mAb. (C) In vivo association between scFvs and WASP. All scFv DNA-trans- fected cell lysates were immunoprecipitated with WASP mAb and analyzed by Western blotting with Myc tag mAb (top panel) or WASP mAb (bottom panel). (D) EVH1 domain-specific binding of scFv T7-WASP15 and scFv DNA cotransfected cell lysates were immunoprecipitated with biotinylated T7 tag mAb. Immunocom- plexes were recovered by on streptavidin-agarose and analyzed by Western blotting with Myc tag mAb (top panel) or T7 tag mAb (bot- tom panel). Arrowheads indicate secondary antibody cross-reactive nonspecific proteins.
• Fig. 4. Expression of anti-WASP scFvs and in vivo interaction between scFvs and WASP in scFv transgenic mice T and B cells. (A) Western blot analysis of protein extracts of T and B cells from the spleens of the 21SHL and 21SHL-CL scFv transgenic mice. The immunoblot was probed with Myc tag mAb. (B, C) In vivo associ- ation between scFvs and WASP. The scFv 21SHL and 21SHL-CL transgenic T and B cell lysates were immunoprecipitated with WASP mAb and Myc tag mAb and analyzed by Western blotting with Myc tag mAb and WASP mAb. Arrowheads indicated secon- dary antibody cross-reactive nonspecific proteins. (D) Both scFv transgenic mice T and B cell lysates were analyzed by Western blot- ting with WASP antibody.
• Fig. 5. Antigen receptor-induced proliferation in anti-WASP scFv transgenic T and B cells, and lymphoid development in anti-WASP scFv transgenic mice. (A) T-cell proliferation. Splenic T cells from anti-WASP scFv 21SHL transgenic, 21SHL-CL transgenic, WASP15 transgenic and wild-type mice were cultured in medium alone or in the presence of CD38 antibody. (B) B-cell proliferation. Splenic B cells from anti-WASP scFv 21SHL transgenic, 21SHL-CL trans- genic, WASP15 transgenic and wild-type mice were cultured in medium alone or in the presence of IgM antibody F(ab’)2 or CD40 antibody. Each stimulation was performed in the presence of exo- genous IL-4. In each experiment, cells were cultured for 48 h, then 10 μμ BrdU was added to the T and B-cell cultures. The cells were reincubated for an additional 16 h, and BrdU incorporation was quantified by ELISA. Values represent means ± SE of triplicate cultures and are representative of three independent experi- ments. Statistical significance is indicated by *(P < 0.05) and **(P < 0.005). (C)-(E) FACS analyses of lymphocytes from wild- type, anti-WASP scFv 21SHL transgenic and 21SHL-CL transgenic mice. Two-color flow cytometric analyses were performed on spleen (C), thymus (D) and bone marrow (E). Percentages of repre- sentative lymphoid populations are noted. The results shown are representative of at least three male mice for each analysis at the age of 8 weeks.
• Fig. 6. IL-2 production was impaired, but not antigen receptor capping induced by TCR stimulation. (A) Splenic T cells from anti-WASP scFv 21SHL transgenic, 21SHL- CL transgenic, WASP15 transgenic and wild-type mice were cultured in medium alone or in the presence of anti-CD3ɛ Ab. Each cell culture supernatant was collected at 24 h. IL-2 in the supernatant was quanti- fied by ELISA. Values are mean ± SE from triplicate cultures and are representative of three independent experiments. Statistical significance is indicated by *(P < 0.005) and **(P < 0.001). (B) Splenic T cells from anti- WASP scFv 21SHL transgenic, 21SHL-CL transgenic, WASP15 transgenic and wild-type mice were incubated with FITC-conju- gated CD3ɛ antibody at either 4 °C or 37 °C for 30 min. The treated cells were placed on polyethylenimine coated eight-well tissue culture glass slides, fixed, analyzed and photographed at x 100 using confocal micro- scopy. The rate of capping of unstimulated and stimulated T cells was determined by counting the number of caps in ≈ 200 cells/ experiment. The wild-type and transgenic mice used for these experiments were 8 weeks old.
• Fig. 7. Subcellular localization of anti-WASP scFvs. Cell extracts of (A) anti-WASP scFvs transgenic T cells and (B) anti-WASP scFv DNA-transfected NIH-3T3 cells were fractionated into the subcellu- lar compartments, cytosolic proteins and membrane/membrane organelles. The fractionated cell extracts were analyzed by Western blot- ting with Myc tag, WASP or Ribophorin I antibodies. (C) Co-localization of anti-WASP scFv and endogenous WASP in the cytosol of T cells. Anti-WASP scFv 21SHL-CL DNA electroporated T cells were fixed and incubated with Myc tag antibody or WASP mAb. After being washed, the cells were stained with FITC-conju- gated anti-rabbit IgG or Alexa Fluor 546-conjugated anti-mouse IgG. The treated cells were analyzed and photographed at × 100 using immunofluorescence microscopy. (D) Anti-WASP scFvs were not polyubiquitinated in the scFv transgenic mice T cells. Immunopre- cipitates with Myc tag antibody (lanes 1 and 2) and cell lysates (lanes 3 and 4) from anti-WASP scFv 21SHL transgenic (lanes 1 and 3) or 21SHL-CL transgenic (lanes 2 and 4) mice T cells were analyzed by Western blotting with Myc tag or ubiquitin antibody. The smear bands (arrow) indicate polyubiquitination of nonspecific proteins in the T cells. The arrowhead indicates secondary antibody cross-reactive nonspecific proteins.
• Discussion
• Experimental procedures
• Construction of GST fusion protein and mAb preparation
• Cloning and construction of WASP-EVH1 scFv intrabodies
• Cells and electroporation/transfection
• Immunoprecipitation and Western blot analysis
• Assay of GST fusion protein binding
• Generation of transgenic mice
• Antigen receptor stimulation
• FACS analysis
• T-cell capping
• Subcellular localization of scFv intrabodies
• Acknowledgements
• References