Báo cáo khoa học: Critical role of the plasma membrane for expression of mammalian mitochondrial side chain cleavage activity in yeast

Critical Role Of The Plasma Membrane For Expression Of Mammalian Mitochondrial Side Chain Cleavage Activity In Yeast

Tác giả: Catherine Duport, Barbara Schoepp, Elise Chatelain, Roberto Spagnoli, Bruno Dumas, Denis Pompon

Lĩnh vực: Sinh hóa học, Công nghệ sinh học

Nội dung tài liệu: Nghiên cứu này khám phá vai trò của màng plasma trong việc biểu hiện hoạt động phân cắt chuỗi bên ty thể của động vật có vú trong nấm men. Các tế bào nấm men được thiết kế có thể chuyển đổi ergosta-5-eneol thành pregnenolone và progesterone. Nghiên cứu tập trung vào việc xác định vị trí của các thành phần phản ứng phân cắt chuỗi bên (CYP11A1, Adrp, Adxp) và ảnh hưởng của chúng đến hoạt động. Các kết quả cho thấy CYP11A1 chủ yếu khu trú ở màng plasma, Adrp ở mạng lưới nội chất, và Adxp ở tế bào chất. Sự phân bố khác biệt này không cản trở phản ứng phân cắt chuỗi bên, cho thấy một cơ chế vận chuyển electron kiểu “shuttle” có thể xảy ra. Nghiên cứu cũng nhấn mạnh tầm quan trọng của nồng độ Adxp trong việc điều hòa hoạt động của CYP11A1 và tổng hợp steroid.

Mục lục chi tiết:

• Critical role of the plasma membrane for expression of mammalian mitochondrial side chain cleavage activity in yeast
• Laboratory d’Ingénierie des Protéines Membranaires, CGM du CNRS, Gif sur Yvette, France; Lead Discovery Technologies, Aventis Pharma, Romainville, France; Functional Genomics, Aventis Pharma, 13 Quai Jules Guesde, F-94403 Vitry sur Seine, France
• Engineered yeast cells efficiently convert ergosta-5-eneol to pregnenolone and progesterone provided that endogenous pregnenolone acetylase activity is disrupted and that heterologous sterol A7-reductase, cytochrome P450 side chain cleavage (CYP11A1) and 3ß hydroxysteroid dehydrogenase/isomerase (3ß-HSD) activities are present.
• CYP11A1 activity requires the expression of the mammalian NADPH-adrenodoxin reductase (Adrp) and adrenodoxin (Adxp) proteins as electron carriers.
• Several parameters modulate this artificial metabolic pathway: the effects of steroid products; the availability and delivery of the ergosta-5-eneol substrate to cytochrome P450; electron flux and protein localization.
• CYP11A1, Adxp and Adrp are usually located in contact with inner mitochondrial membranes and are directed to the outside of the mitochondria by the removal of their respective mitochondrial targeting sequences.
• CYP11A1 then localizes to the plasma membrane but Adrp and Adxp are detected in the endoplasmic reticulum and cytosol as expected.
• The electron transfer chain that involves several subcellular compartments may control side chain cleavage activity in yeast.
• Interestingly, Tgllp, a potential ester hydrolase, was found to enhance steroid productivity, probably through both the availability and/or the trafficking of the CYP11A1 substrate.
• Thus, the observation that the highest cellular levels of free ergosta-5-eneol are found in the plasma membrane suggests that the substrate is freely available for pregnenolone synthesis.
• Keywords: CYP11A1; plasma membrane; ergosta-5-eneol; Tgllp.
• The large family of mammalian cytochrome P450 enzymes includes drug metabolizing enzymes and enzymes that mediate individual steps in the biosynthesis of biologically active compounds.
• Our interest is focused on the cytochrome P450 enzymes that are involved in the synthesis of steroid hormones.
• These steroids are critical for mammalian life and are involved in such distinct processes as stress response, immunosuppression, ion balance, general metabolite homeostasis and fetal, neonatal and gonadal development [1].
• Eukaryotic steroidogenic cells produce a large array of steroids using a limited set of cytochrome P450 enzymes [2].
• The biosynthesis of all hormonal steroids begins with the side chain cleavage (SCC) of cholesterol [3] to form pregnenolone, the key precursor of biologically active steroids in all tissues [4,5].
• This reaction is catalysed by cytochrome P450scc (also designated CYP11A1 [6]), a mitochondrial protein located on the matrix face of the inner membrane that requires electrons for activity.
• These electrons are transferred from NADPH through a specific transport chain involving adrenodoxin reductase (Adrp) and adrenodoxin (Adxp) [7].
• Adxp is a small soluble iron-sulfur protein localized to the mitochondrial matrix, and Adrp is a larger flavodoxin protein bound to the inner mitochondrial membrane of steroid-producing cells [8].
• For many years, pregnenolone formation has been considered to be the rate-limiting step in steroidogenesis [9].
• It has been shown that to initiate and sustain steroid production, a constant supply of cholesterol must be available in the cell.
• Furthermore, there must be a mechanism to ensure the delivery of this substrate to the site where it is cleaved in the inner mitochondrial membrane, where CYP11A1 resides.
• For example, substrate unavailability is a common cause of congenital lipoid adrenal hyperplasia, a disease characterized by a dramatic decrease in steroid synthesis [10].
• In the latter case, mutation(s) in the steroidogenic acute regulatory protein (StAR) protein correlate(s) clearly with the absence of pregnenolone synthesis.
• The well-characterized StAR protein is involved in the rapid transport of cholesterol to the inner mitochondrial membrane [11].
• In contrast, the factors and processes responsible for the intracellular supply of cholesterol to the outer mitochondrial membrane are poorly understood.
• It is known, however, that cholesterol is mobilized from cellular storage sites, such as lipid droplets, in response to trophic hormones [12].
• This mobilization requires the enzyme cholesteryl esterase, which mediates the release of free cholesterol from cholesterol esters.
• In addition, the maintenance of cellular architecture requires a stringent regulation of the concentration of free cholesterol.
• This is ensured by the enzyme, acyl coenzyme A cholesterol acyltransferase (ACAT), which catalyzes its esterification [13].
• The levels of expression of various proteins (Adxp, Adrp, CYP11A1) involved in the reaction can also affect the efficiency of cholesterol side chain cleavage.
• Indeed, it is apparent that the expression of these three proteins is differentially modulated in hormone-producing tissues.
• For example, the corpus luteum and adrenal cortex contain higher concentrations of Adxp and Adrp than does the placenta ([14,15]).
• In the latter case, the concentration of Adrp limits the production of pregnenolone [15] through a mechanism involving oxidized Adxp, that is in excess in the human placenta [16].
• Whether ternary complex formation is required for the optimal flow of electrons from NADPH to CYP11A1 remains controversial.
• However, recent reports reinforce the idea that there is a complex containing CYP11A1, cytochrome P450 11B1 (CYP11B1), Adxp and Adrp in the mitochondrial membrane of steroid producing cells [17,18].
• As reported previously [19], the simultaneous expression of Arabidopsis thaliana sterol A7-reductase (A7-Red), bovine CYP11A1, Adxp, Adrp and human 3ß-hydroxy-steroid deshydrogenase/isomerase (3ß-HSD) in modified Saccharomyces cerevisiae cells allows the self-sufficient biosynthesis of pregnenolone and progesterone (Fig. 1), thus reproducing the properties of steroidogenic tissues of higher eukaryotes.
• In these recombinant yeast strains, the predominant sterol is ergosta-5-eneol, that replaces ergosterol in membranes and acts as a substrate for CYP11A1.
• Ergosta-5-eneol differs from ergosterol in that the C7-C8 doublebond is reduced and there is no doublebond at position C22.
• It also differs from cholesterol in that it has a methyl group at position C24.
• Ergosta-5-eneol is synthesized [19] and esterified [20] in processes similar to those that control cholesterol accumulation in mammalian cells.
• Ergosta-5-eneol and cholesterol act similarly as a substrate for CYP11A1 and allow proper folding of CYP11A1 in membrane microdomain.
• The aim of this study was to determine whether recombinant yeast can be used as a model system to decipher the SCC reaction and its potential regulation during steroidogenesis.
• To do so, we studied the influence of ergosta-5-eneol availability and electron carrier expression level on the production of pregnenolone and progesterone, and we also determined the localization of the components of the SCC reaction.
• We found that Adxp, Adrp and CYP11A1 appear to localize to three compartments outside the mitochondrion, without impairing the reaction.
• This finding has direct implications for the potential formation of a complex containing CYP11A1, CYP11B1, Adxp and Adrp.
• Materials and methods
• Culture conditions and genetic methods
• Yeast media, including SG (synthetic medium containing 2% glucose), SL (synthetic medium containing 2% galactose) and YP (complete medium without carbon source) are described [65].
• Low-density and high-density cultures were obtained as reported previously [19].
• Standard methods were used for transformation [21] and genetic manipulation of S. cerevisiae [22].
• pUC-HIS3ADX is an integrative plasmid derived from pUC-HIS3 [23] that carries the TEF1 prom::matADX::PGK1 term expression cassette.
• This expression cassette contains the mature form of the ADX CDNA [24] under the control of the TEF1 promoter and PGKI terminator [25].
• The matADX expression plasmid pTG10917 contains an E. coli replicon with an S. cerevisiae replicon and a URA3 marker.
• The vector pUC18-HIS3 was linearized at the unique Xhol site in the intergenic region between the S. cerevisiae HIS3 and DDE1 genes and blunt-ended with the Klenow enzyme.
• A NotI linker was introduced into this linearized vector, giving pUC-HIS3N.
• The 1235-bp NotI fragment carrying the expression cassette, TEF1 prom::matADX::PGKI term, was isolated from pTG10917 (see above) and subcloned into the NotI site of pUC-HIS3N to obtain pUC-HIS3ADX.
• pYeDP60 is a 2µ replication origin-based expression plasmid that contains the URA3 and ADE2 selectable markers, a galactose inductible GAL10/CYC1 promoter, multiple cloning sites, and the PGKI terminator [26].
• pCD69, a 2µ-URA3-ADE2 plasmid expressing TGL1 under the control of the GAL10/CYCI promoter was constructed as follows.
• The TGL1 open reading frame was isolated from FY1679 genomic DNA by amplification using oligonucleotides lip1 (5′-atagacacgcaaacacaaatacaca cactaaattaataatgaccggatcATGTACTTCCCCTTTTTAGG CAGAT-3′) and lip2 (5′-cagtagagacatgggagatcccccgcgg aattcgagctcggtacccgggTCATTCTTTATTTAGAGCATC CAGC-3′).
• The sequences in lower-case are complementary to the end of the GAL10/CYC1 promoter (lip1) and to the beginning of the PGK1 terminator (lip2).
• The 1647 bp PCR fragment was transformed into yeast along with BamHI-EcoRI-linearized pYeDP60, permitting cloning by homologous recombination between the plasmid and the PCR fragment and giving pCD69.
• The pDP10037 (2μ-URA3-TRPI), pCD63 (2μ-URA3- TRPI) and pV13SCC (2μ-URA3) plasmids were constructed as reported previously [19].
• pDP10037 carries the GAL10/CYC1prom::matADR::PGK1term and GAL10| CYC1prom::matADX::PGK1term expression cassettes separ- ated by the URA3 marker.
• pCD63 was obtained from pDP10037 by replacing sequences coding for the mature Adrp (preceded by a methionine codon) by sequences coding for the mature form of cytochrome CYP11A1 (preceded by a methionine codon).
• pV13SCC expresses the mature form of CYP11A1 (preceded by a methionine codon) driven by the GAL10/CYC1 promoter.
• Strains
• Yeast strains used in this study are listed in Table 1.
• The structure of the CA10 A7 reductase expression locus has been verified by PCR, Southern and direct sequencing analysis of the promoter region, showing that it contains the GAL10/CYC1 promoter instead of the expected PGK1 promoter (Table 1).
• The APAT-deficient strain, CA14, was generated by disrupting the ATF2 gene of CA10 with the KanMX4 cassette, which confers G418 resistance.
• Primers 5’ATF2-Kan 5′-AGACTTTCAAACGAATAATAACTT CAGCAATAAAAATTGTCCAGGTTAATtccagcgacatg gaggccc-3′ and 3’ATF2-Kan: 5′-TTGTACGAGCTCGG CCGAGCTATACGAAGGCCCGCTACGGCAGTATC GCAcattcacatacgattgacgc-3′ (nucleotides in lower case are specific to the KanMX4 module) were used for PCR with pFA6-MX4 as a template [27] to produce the KanMX cassette flanked by ATF2 sequences [23].
• The strain, CA19 was obtained by introducing the GAL10/CYC1 prom::3ẞHSD::PGK1term cassette into the region between the HIS3 and DDE1 genes of CA14, as previously described [19].
• CDR07 (an FY-1679–18B derivative that contains only the GAL10/CYC1prom::47 reductase::PGK1term expression cassette) was obtained by sporulation of the diploid resulting from a cross between CA10 (MAT) and FY1679-18B (MATa).
• TGY120.2 (MAT) was obtained by transformation of FY1679-28C (MATa) with XbaI-linearized pTG10925.
• This plasmid contains an S. cerevisiae genomic DNA fragment covering the LEU2 and SPL1 locus derived from pFL26CD [19].
• A bovine mature Adrp expression cassette (TEF1 prom:: matADR::PGK1term) [24] was introduced into the unique NotI site of pFL26CD, that is in the noncoding region between LEU2 and SPL1.
• Transformed colonies were grown in selective medium, and the expression of mature Adrp was verified by Western blot analysis as described [24].
• One clone, TGY120.2 MATa, was selected for further studies.
• The yeast strain, CA15 was isolated by mating CDR06 (MATa) to TGY120.2 (MAT), that contains the TEF1prom::matADR::PGK1term cassette in the intergenic region between LEU2 and SPL1.
• The strain, CA17 was generated by integrating a TEF1 prom::matADX::PGK1term cassette into the intergenic region between the HIS3 and DDE1 of CA15 with the PUC-HIS3ADX integrative plasmid.
• The arel::KanMX4 are2:: HIS3 double mutant strain CA23 was constructed by crossing CA10 (ΜAΤα ARE 1
• Table 1. Yeast strains and expression plasmids.
• Strain or plasmid
• Relevant genotype or encoded protein (promoter)
• Source
• S. cerevisiae strains
• FY1679
• MATalarho, GAL2, ura3–52, trp1-463, his3-4200, leu2-11.
• [64]
• CDR07
• MATa, rho,GAL2, ura3-52, trp1-463, his3-4200 leu2-41, ade2::GAL10/CYC1::17Reductase::PGK1.
• This study
• CDS04
• MATa, rho⁺, GAL2, ura3–52, trp1-463, his3-4200, leu2-11, are1::G418R, are2::HIS3.
• [28]
• CA10
• MATa, rhot, GAL2, ura3–52, trp1-∆6, his3-A200, erg5::HYGROR, ade2::GAL10/CYC1::17Reductase::PGK1, LEU2::GAL10/CYC1::matADR::PGK1.
• [1